Diese Webseite verwendet im Normalbetrieb keine Cookies. Es sei denn, Sie schreiben hier Kommentare. Oder Sie versuchen sich anzumelden.cookies policy.     HABS KAPIERT

E.coli O104:H4 in der PetrischaleWer suchet, der findet. Das E.coli O104:H4 Bakterium – auch HUSEC-41 genannt – gibt es jetzt zum Selberbauen. Nach langer und nervenaufreibender Recherchearbeit präsentiert Eigensinnig.org als erster Blog weltweit die Bastelanleitung.

Die wichtigste Komponente des Bakteriums – der DNA-Strang – besteht wie üblich aus Molekülen vier unterschiedlicher Materialien. Das wären Adenin (A), Guanin (G), Thymin (T) und Cytosin (C). Die gibt es gebrauchsfertig in jedem gut sortierten Bastelgeschäft. Oder bei OBI. Doch Augen auf beim Teilekauf. Bisweilen wird billiger Thymian anstelle von Thymin oder Guarkernmehl statt Guanin in die Bio-Bastelsets gepackt. Also nicht bei irgendwelchen windigen Internet-Händlern bestellen.

Ich will es nicht zu spanned machen. Deshalb hier zunächst einmal die DNA-Sequenz.

E.coli O104:H4 Bastelversion:
GAAAACGTCGGGTAACGCGCGTTATACCTATCTGGCGGCATGGGGCGCAGCGGATAAAGCTGAcggtggcgataaagccaaaaCCGAACAGTTTATGACC
CAGTTCCTGAAAAATGTTGAAGTGTTCGATACCGGCGGTCGTGGCGCAACCACCACTTTTGCCGAGCGTGGCCTGGGCGATGTGCTGATTAGCTTTGAAT
CGGAAGTGAACAACATCCGTAAACAGTATGAagcacagggctttgaagtggTGATCCCGAAAACCAATATTCTGGCGGAATTCCCGGTGGCGTGGGTCGA
TAAAAACGTGCAGGCCAACGGTACGGAAAAAGCAGCAAAAGCCTACCTGAACTGGCTCTACAGCCCGCAGGCGCAGACCATCATCACCGACTATTACTAC
CGCGTAAATAACCCGGaagtcatggacaaactgaaaGATAAATTCCCGCAGACCGAGCTGTTCCGCGTGGAagacaaatttggctcctggccggaagtga
tgaaaacccacttcacCAGCGGCGGCGAGTTAGACAAGCTGTTAGCGGCGGGGCGTAACTgATGTTTGCAGTTTCATCAAGACGCGtgctgccgggcttt
accttaagcctCGGCACCAGTCTGCTGTTTGTGTGCCTGATTTTGCTGCTGCCGCTCTCCGCGCTGGTGATGCAGCTGGCTCAGATGAGCTGGGCGCAGT
ACTGGGAGGtgatcaccaacccacaagtgGTCGCGGCCTACAAAGTGACGCTGCTGTCGGCGTTTGTGGCATCGatttttaacggcgttttcggTCTGCT
GATGGCGTGGATTTTAACACGTTATCGCTTTCCGGGCCGCACGCTGCTTGATGCGCTGATGGATTTACCCTTTGCGCTGCCAACGGCAGTCGCCGGTTTA
ACGCTGGCCTCGCTCTTTTCCGTAAACGGTTTTTACGGTGAATGGCTGGCGAAGTTTGATATCAAAGTCACCTATACATGGCTGGGGATTGCGGTGGCGA
TGGCCTTTACCAGCATTCCGTTTGTGGTGCGTACCGTGCAGCCGGTgctggaagagttaggcccggaatatGAAGAAGCGGCGGAAACGCTTGGTGCAAC
GCGCTGGCAGAGTTTCTGCAAAGTGGTGctgccggagctttctccggcGCTGGTGGCGGGCGTGGCGCTGTCGTTTACCCGTAGTCTTGGTGAATTTGGC
GCGGTGATTTTTATCGCCGGGAACATCGCCtggaagacgaaagtgacgtCGCTGATGATTTTTGTGCGCTTGCAGGAGTTTGATTACCCGGCGGCGAGCG
CGATTGCTTCGGTGATCCTCGCGGCATCCCTGCTGCTGCTGTTCTCAATTAACACTCTGCAAAGTCGCTTTGGTCGGCGTGTGGTAGGTCATTAATGGCG
GAAGTTACCCAATTGAAGCGTTATGACGCGCGCCCGATTAACTGGGGCAAATGGTTTCTAATTGGCATCGGGATGCTGGTTTCAGCGTTCATCCTGCTGG
TGCCGATGATTTACATCTTCGTGCAGGCATTCAGCAAGGGGCTGATGCCGGTTTTACAGAATCTGGCCGATCCGGACATGCTGCACGCCATCTGGCTGAC
GGTGATGATCGCGCTGATTGCCGTACCGGTAAACCTGGTGTTCGGCATTCTGCTGGCCTGGCTGGTGACGCGCTTTAACTtccctggacgccagttactg
CTGACGCTACTGGACATTCCGTTTGCCGTATCGccggtggttgccggtctggtGTATCTGCTGTTCTACGGCTCTAACGGCCCGCTGGGCGGCTGGCTGG
ATGAACATAATCTGCAAATTATGTTCTCCTGGCCCGGAATGGTGCTGGTCACCATCTTTGTGACGTGTCCGTTTGTGGTGCGCGAGCTGGTGCCGGTGAT
GTTAAGCCAGGGCAGCCAGGAAGACGAAGCGGCGATTTTGCTTGGCGCGTCTggctggcagatgtttcgccgcgtcacattGCCGaacattcgctgggcg
ctgctttatggcgtggtgttgaccaacgCCCGCGCAATTGGCGAGTTTGGCGCGGTGTCGGTGGTTTCCGGCTCGattcgcggcgaaaccctgtcgctGC
CGTTACAGATTGAATTGCTGGAGCAGGACTACAACACCGTCGGCTCCTTTACCGCtgcggcactgttaacgctgaTGGCGATTATCaccctgtttttaaa
aagtatgTTGCAGTGGCGCCTGGAGAATCAGGATAAACGCGCACAGCAGGAGGAACATCATGAGCATTGAGATTGCCAATATTAAGAAGTCGtttggtcg
cacccaggtgctGAACGATATCTCACTGGATATTCCTTCAGGTCAGATGGTCGCGTTGCTGGGGCCGTCCGGTTCCGGGAAAACCACGCTGCTGCGCATT
ATCGCCGGGCTGGAGCATCAAACCAGCGGGCATATTCGCTTCCACGGCACCGACGTCAGCCGCCTGCACGCGCGCGATCGCAAGGTCGGTTTCGtgttcc
agcattacgcgctgttccgccatatgacgGTATTCGACAATATCGCTTTTGGCCTGACGGTGCTGCCGCGTCGCGAGCGCCCGAATGCCGCAGCCATCAA
AGCGAAAGTGACAAAATTGCTGGAAATGGTCCAGCTTGCGCATCTGGCGGATCGTTATCCGGCGCAGCTTTCCGGCGGCCAGAAACAGCGTGTGGCGCTG
GCGCGCGCGCTGGCTGTAGAACCGCAAATTCTGCTGCTTGATGAACCGTTTGGCGCGCTGGATGCGCAGGTGCGTAAAGAGCTGCGTCGCTGGCTGCGTC
AACTGCATGAAGAGCTGAAATTCACCAGCGTGTTTGTGACCCACGACCAGGAAGAGGCGACCGAAGTAGCCGATCGTGTAGTGGTGATGAGTCAGGGGAA
TATTGAACAGGCTGATGCGCCGAATCAGGTATGGCGCGAACCAGCGACCCGTTTTGTACTCGAATTTATGGGCGAAGTGAACCGCCTGCAGGGAACCATT
CGCGGCGGGcagttccatgttggcgcacaTCGCTGGCCGCTGGGCTACACACCTGCTTATCAGGGGCCGGTGGATCTCTTCCTGCGCCCGTGGGAAGTGG
ATATCAGCCGCCGTACCAGTCTCGATTCGCCGCTGCCGGTACAGGTACTGGAAGCcagcccgaaaggtcactacacccaattagtGGTGCAGCCGCTGGG
GTGGTACAACGAACCGCTGACGGTCGTGATGCATGGCGACGATGCCCCGCAGCGTGGCGAGCGTTTATTCGTTGGTCTGCAACATGCgcggctgtataac
ggcgacgagCGTATCGAAACCCGCGATGAGGAACTTGCTCTCGCACAAAGCGCCTGATAGGTTGAGTGAATGTTAAACGCCCGGAGGCGCTTCCCGCGAT
CCGGGCTTTTTAATGGCAAGGTTTGTAACCTGTAGACCTGATAAGACGCGCAAGCGTCGCATCAGGCAACACCACGTATGGATAGAGATCGTGAGTacat
tagaacaaacaataggCAATacgcctctggtgaagttgcagcgaaTGGGGCCGGATAACGGCAGTGAAGTGTGGTTAAAACTGGAAGGCAATAACCCGGC
AGGTTCGGTGAAAGATCGTGCGGCACTTTCGATGATCGTCGAGGCGGAAAAGCGCGGGGAAATTAAACCGGGTGATGTCTTAATCGAAGCCACCAGTGGT
AACACCGGCATTGCGCTGGCAATGATTGCCGCGCTGAAAGGCTATCGCATGAAATTGCTGATGCCCGACAACATGAGCCAGGAACGCCGTGCGGCGATGC
GTGCTTATGGTGCGGAACTGATTCTTGTCACCAAAGAGCAGGGCATGGAAGGTGCGCGCGATCTGGCGCTGGAGATGGCGAATCGTGGCGAAGGAAAGCT
GCTCGATCAGTTTAATAATCCCGATAACCCTTACgcccattacaccactaccggGCCGGAAATCTGGCAGCAAACCGGCGGGCGCATTACCCATTTTGTC
TCCAGCATGGGAACAACCGGCACTATCACCGGCGTTTCACGCTTTATGCGCGAACAATCCAAACCAGTAACGATTGTTGGCCTGCAGCCGGAAGAAGGCA
GCAGTATTCCCGGCATTCGCCGCTGGCCTGCGGAATATctgccggggattttcaacgcTTCTCTGGTGGATGAGGTGCTGGATATTCATCAGCGCGATGC
AGAAAACACCATGCGCGAACTGGCAGTGCGGGAAGGAATATTCTGTGGCGTCAGCTCCGGCGGCGCGGTTGCCGGAGCACTGCGGGTGGcaaaagctaac
cctggtgcggtgGTGGTAGcgatcatctgcgatcgtggcgatcgctacctttccaccggggtgtttggggaagagcattttagccagggggcggggattt
aagattattgcgcAGGCACCGTTTTATCCGTCTGCGCAATTAGCGCATGTAAAAAAGGCTGTGCGTTCTCAtcgctcttaccggggatcttcACAATATA
CGGCTTCCCGGTAATCGATGACGACGAAGCAACCTTATCAATAAACTGCTCGGCAGTGTCAATGCGGTTACGGGTATTGCCCAGCTTCAGACGCAGATGA
GAAACCGCTTCATCGCAGGTATGTTCATCACCGTTGCGCACAAATATCAAATCCTTTTTCTGTGCTAATCCCTCCAGCATGGCGTTGATGCGGGCTTCTT
CATGGGCAGTTAACTtcgcgtaagcggggagtgtcATTAGTAGTGTAATGACCAGACAAATGATTTTCTTCATTGAATTACCTTATCCTTGTTTTGTGAT
AGCCGATTTGACTGCCAGAATCAGGTAAAGTTTCGGTTGGAATACGATGAGGATCATcggcaaggagAaaaaattaaaTGAGTAGTTTGTTGTTGTTTAA
CGATAAGAGCAGGGCGCTGCaggcggatatcgtcgccgtgcagtcgcaggtGGTTTACGGCAGCGTGGGCAACAGCATTGCCGTGCCTGCTATCAAACAG
AACggtctgaatgTttttgccgtgccgacggtattgctgGAGAGAGAGACCGCATTATGACACTTTCTACGGTGGTGcgattccggaTGAATGGTTTAGG
GTTATTTGCGTGCGCTTCATGAGCGTGATGCGCTGCGCCAGCTGCGCGCTGTAACCACGGGCTATATGGGAACGGCATCGCAAATCAAAATCCTTGCCGA
GTGGCTGACTGCGCTACGCAAAGACCATCCTGACCTATTGATCATGGTCGATCCGGTGATTGGCGATATTGATAGCGGAATTTATGTCAAACCTGACCTT
CCCGAGGCGTATCGACAATATTTACTGCCGCTGGCGcagggaattacccccaatatctttgagctggAAATCCTGACCGgtaaaaATTGCCGCGATCTCG
ACAGTGCCAttgctgccgcaaaaagtctgCTTTcagacacattaaaatgggtgGTGATTACCAGCGCCTCCGGTAATGAAGAAAATCAGGAGATGCAGGT
GGTGGTGGTCAGTGCCGACAGCGTGAATGTCATTTCCCATTCACGGGTAAAAACCGACCTGAAAGGGACTGGCGACCTGTTTTGTGCTCAGCTTATCAGT
GGTTTGCTGAAAGggaaggcgttaaacGatgcggtgcaccgttcggggttgCGCGTACTGGAAGTGATGCGCTACACCCAGCAGCATGAGAGCGATGAat
tgattttgccgccgctggCGGAAGCATAAAAAATGGCGCCGatgggcgccatttttcactgCGGCAAGAATTACTTCTTGATgcggataaccggggtttc
acCCACGGTTACGCTACCGGACAGTTTGATCAGTTCTTTGATTTCGTCCATGTTGGAGATAACAACCGGAGTCAGGGTAGACTTGGCTTTCTCTTCCAGT
AGCGGCAGATCAAATTCAATGACAGTATCGCCAACTTTCACGCGCTGACCTTCTTCAGCAATACGCTTGAAGCCTTCGCCTTTCAGTTCAACGGTGTCGA
TACCGAAGTGGACGAACAGTTCAACGCCGCTATCAGATTCGATAGAGAATGCGTGGTTGGTTTCAAAGATTTTACCAATGGTGCCGTCTACTGGCGCGAC
CATTTTGTTACCCGTTGgtttgatagcaataccatcaccaacgattttttccgcAAAAACGACATCCGGCACGTCTTCGATATTGACGATCTCGCCAGAG
AGCGGAGCAATGatctcaatagttccggtatccttcTTGTCGTCGGAAACCAGAGATTTcagtttatcgaacaaacccatgatcttcTCCTAAGCAGTAA
ATTGGGCcgcatctcgtggattagcagATTGTTTTTTCTTCAATGAACTTGTTAACCAGCGTCATTAACTCGTCCGTTGTCGGTTGAGCAAGAGCCTGCT
CTGCTAACACCTTCGCATCTTCGAAGTTCGTGTTACGGATAATCTTCTTAATGCGCGGGATAGAAATGGCGCtcatagagaattcgtccagaCccatccc
cagCAACAGAAGTGTAGCACGTTCATCGCCAGCAAGCTCACCACACATGCCAGTCCATTTGCCTTCAGCATGAGAAGCATCAATAACTTGCTTGATCAAG
TTCAGCACGGACGGTGACATTGGCTGGTAAAGGTGTGAAATCATATCATTACCACGGTCAACTGCCAGAGTGTACTGCGTTAAATCATTGGTGCCGATAC
TAAAGAAATCAACTTCTTTGGCTAAATGACGTGCAATTGTTGCGGCAGCCGGTGTTTCCACCATTACGCCGATTTCAATTGACTCGTCAAACGCTTTATC
TTCGTCGCGCAGTTCCTGTTTGTAGATTTCGATCTCTTTGCGCAGTGCACGCACTTCTTCAACAGAGATGATCATCGGGAACATAATGCGCAATTTACCG
AAAGCCGAGGCACGCAGGATAGCGCGGAGCTGATCGCGCAGGATCTCTTTACGATCCATCGCGATACGGATAGCGCGCCAGCCGAGGAACGGGTTCTCTT
CTTTCGGGAAGTTCATGTATGGCAGCTCTTTGTCGCCGCCGATGTCCATGGTACGAACGATAACCGCTTGCGAGCCACACGCTTCAGCCACTGCTTTGTA
AGCAGCAAACTGTTCTTCTTCAGTGGGCAGTGCGTCGCGGTCCATGAACAGGAACTCAGTACGATACAGACCAACGCCTTCAGCGCCGTTACGCTCTGCA
CCTTCAACGTCACGAACCGTACCAATGTTAGCGCATACTTCTACCTGGTGACCGTCCAGCGTAATAGCTGGCAGATCTTTCAGTTTAGcaagctctgctt
tttcagaaGCCACTTGCTCCTGAacagcgcgcattttatcaatAACTTCGTTGGTTGGATTGACGTAAACCTGATTATTTACGGCATCCAGAATCAGATA
GTCGTCATTTTTCACCTGAGAGGTGACGCTACCGGTACCCACGATAGCAGGTAGTTCCAGAGAACGCGCCATGATAGAGGTGTGGGAAGTACGGCcaccc
gcgtcggtgatgaaaCCCAGCACCTTCTTCAGGTTCAGCTGTGCGGTTTCGGACGGCGTCAGGTCAGCGGCAACCAGAATGACTTCATCCTGAATGGCGC
TCAGGTCGATAATCTTCAGGCCCAGGATGTTGCGCAGCAGGCGCTTACCGATATCACGTACGTCAGCCGCACGTTCTTTCAGGTATTCATCATCCAGCTC
TTCCAGGGCAGAAGCCTGACCTTCGATAACTTCATGAGCAGCTGCGTCAGCTGTCATGTGCTTATCTTTAATCAGGGCTATGATTTCCTGCTCCAGCTCC
TCATCTTCGAGCAGCATAATATGCCCTTCAAAGATGGCTTCTTTTTCTTCACCGAACGTTTCAccagctttcgttttgatcgtttccagctgGGCTGATG
CCTTGGCACGACCGCTCAGAAAACGTTCAACTTCCTGATCAACCTGGtcggcagaaatttttttccgGTCAATGACAATTTCGTCTTCTTTCAGAAGCAG
AGCTTTACCgaaagcgatacccggggatgCTAAAATGCCTGAAATCATAACCCTACCTTACttgtgactgatttttaaaagaacccgggaaattactcga
gtTCCGCCATCAGTTTAACCAGATGTTCAACCGCTTTCTGCTCGTCTTCGCCTTCTGCGGAGATAGTCACAACGGTACCTTGAGTCAGGCCCAGAGTCTG
CAGTTTAAACAGGCTTTTCGCGCTGGCGCTTTTGCCGTTGGAAGTCACAGTAATTTCAGAAGTGAAGCccttagCTTCTTTTACAAACTGGGCAGCAGGG
CGGGTGTGCAGACCGTTCGGAGCGGTAATGGTAACTTCTTGCTGGAACATTGTATTTCCCCAACTTATAGGTTTAGTGTTGTGGAACTAAAGTCTAGCCT
GGCGGTTCGACTTTAGCCTGTATTGTTAGCGCCAGTTTTTAACAGACGCGACGCACGAAGAGCGCAATACAGTCCATTGCTGGCGGGTGTTGACCGCTGA
CGTTTCGTACGTCATTAAACATTATGCCGCTAAAGGAAGAATTGAACCAAATCATAAAATCGATTCAGCTTTGGCTTTTCCTGTAACGATTAATTTCGCG
CATCAAAATAATTAGTCTGGTTAAATACCAGTTCCGACAGGCTGAATCAATGCCAGGAGGGGCGAAAGTTTGAagcaggccacAaaaaagcaccTAAAAA
GGTGCTTTTTTACGCATTTTTAACAAGCTGGCATTACTGTTGCAGTTCTTTCTCAGTGAAGAGATCGGCAAACAATGCGGTGCTTAAATAACGCTCACCC
GATGACGGTAGAATAACCACAATATTCTTGTTGGTAAAGCTTTCATCTTCTTGTAGTTTCAACGCCGCAGCAACAGCTGCTCCAGAAGAGATACCTGCAA
GAATACCTTCTTCTTCCATCAGACGACGCGCGGTAGAAATCGCTTCTTCATTGGTGATGCCAATGACTTTATCGACCAGCTTGAGATCGAGGTTAGCTGG
GATAAAACCAGCGCCAATACCCTGAATTTTATGCGGGCCAGGTTTAATCTCTTCACCAGCCAGTGCCTGGGCGATAACTGGAGAATCGGTTGGCTCAACG
GCGACAGagataagatcggtcttgcctTTGGTGCCTTTAATGTAGCGGCTGACGCCAGTCAGcgtaccgccagtcccaacgccaGCAATAAATACATCAA
CCTGACCGTCGGTATCTTCCCAGATCTCCggaccggtggttttttcgtgAATTTCAGGGTTTGCCGGATTGCTGAATTGTTGCAGCAGCAGGTATTTCTC
TGGATTGCTGGCGACAATTTCTTCTGCTTTTTGGATTGCGCCTTTCATGCCTTTAGCACCTTCCGTCAGCACCAGGTTTGCACCTAACGCTTTCAGCAGC
TTGCGGCGTTCAATACTCATGGTTTCTGGCATGGTCAGGGTGAGTTTGTAACCGCGAGcggcagctacataggccagtGCAATCCCGGTATTACCGCTGG
TTGGTTCAACCAGTTCAACGCCTGGTTTCAGCACGCCGCGCTTTTCGGCATCCCAAATCATGTTGGCACCGATACGGCACTTAACGCTGAAGCTGGGGTT
ACGAGATtccaccttcgCcagaatgcgtCCGTTACCGATGCGATTCAGGCGAACCAGCGGCGTGTGACCGATAGTCAGCGAGTTATCTTCAAAAATCTTA
CTCATGGCCTGTCCTTAACTGTATGAAATTGGGATACAACAGGTAGCATACCCGCTCAGAGAATATGCGGAAGTAAGGATTTAGCATATCTATATACAGA
AGGGAAATAATGACATGCAAGATGGAATAAGGGGCGgcataagccacccctgtttcACACAAACGGTTTACAAAATAACCGGTAGATCGAGA

Adenin (A), Guanin (G), Thymin (T) und Cytosin (C) sind Basen. Gemeint sind chemische Basen, nicht der Verwandtschaftsgrad. Diese Basen gilt es nun paarweise aneinander zu fügen, wobei das jeweils nächste Basenpaar unten angesetzt wird. Sobald der ganze DNA-Strang zusammengestellt wurde, errechnen wir aus der Kette die Prüfsumme. Wer etwas anderes als ATAC*) herausbekommt, hat irgendwo unterwegs etwas falsch gemacht und muss neu anfangen. Aber wenn sorgfältig gearbeitet wird, ist ein Fehler so gut wie ausgeschlossen.
*) Reiner Zufall

DNA-DoppelhelixWir haben jetzt eine ziemlich lange Molekülkette. Die muss nun zu einer so genannten Doppelhelix gewendelt werden. Ungefähr wie der Wolframfaden in einer Glühlampe. Wer sich damit schwer tut – so geht es den Meisten am Anfang – kann sich im örtlichen Handarbeitsladen eine Strickliesel besorgen. Damit geht es dann fast wie von selbst. Nicht vergessen, am Schluss die beiden Enden miteinander zu verbinden. Sonst spult sich unsere Doppelhelix in der Zelle wieder ab und dann sieht es in unserem Bakterium aus wie in einem Uhrwerk, bei dem die Feder aus dem Käfig gesprungen ist. Unnötig zu erwähnen, dass aus der Mitose dann auch nichts wird. Doch wenn es beim ersten Mal nicht so schön wie auf der rechten Abbildung aussieht; nur nicht den Mut verlieren. Es ist noch kein Meister vom Himmel gefallen, und ein Schöpfer schon gar nicht.

E.coli O104:H4Der wichtigste Teil ist geschafft. Als nächstes brauchen wir noch ein passendes Gehäuse für unseren selbst gebastelten Nucleoid. Puristen mögen sich jetzt aus Lipiden, Plasmiden, Polybetahydroxyfettsäuren und Cytoplasma selbst so ein Gehäuse bauen. Doch Obacht geben; die Zelle, die dabei rauskommen soll, ist kein Eukaryot sondern ein Prokaryot. Wird gerne mal verwechselt.

Aber natürlich geht es auch schneller, indem wir einfach ein handelsübliches E.coli-Bakterium nehmen*) und den vorhandenen Nucleoid ausbauen. An seine Stelle setzen wir unsere selbstgebaute DNA-Doppelhelix ein. Das fertige Bakterium sollte dann wie auf dem linken Bild aussehen. Also wie ein ausgewilderter Tampon. Wer kreativ ist, kann freilich noch Form und Farbe variieren.
*) Wer gerade keines zur Hand hat muss nur ein wenig warten

Viel Spaß mit dem hoffentlich gelungenen E.coli O104:H4 Bakterium. Das ist auf jeder Party der Knüller. Vor allem, wenn man gleich mehr davon mitbringt. Allen Spaßvögeln sei jedoch geraten, die Dinger nicht in der Nähe des Salatbuffets auszupacken. Das kommt zurzeit nicht so gut. 😉

MfG
Hans

Die Kommentarfunktion ist geschlossen.